1.4 Mutationen, Mutagene

1.4.1

Genmutation, Ursachen und Auswirkungen von Basenmutationen, DNA-Reparatur

Überblick über Mutationsformen

Die bisher besprochenen Vorgänge um die Verdopplung des Erbguts (Replikation) und die Realisierung der genetischen Information (Transkription, Translation) sind alle höchst kompliziert und bedürfen eines gewaltigen Aufwandes an Energie und Material in der Zelle. Dabei geschehen spontan Fehler. Spontane oder induzierte Änderungen des Erbgutes werden als Mutationen bezeichnet.

Wird z.B. ein Gen falsch abgeschrieben, ensteht ein modifiziertes oder sogar defektes Protein, was sich in einem veränderten Stoffwechsel oder als Krankheit äußert. Man nennt solche Mutationen Genmutationen.

Links ist das Hämoglobin-Molekül abgebildet. Eine Genmutation im Gen der ß-Kette sorgt für eine veränderte Hämoglobinstruktur, sichelzellartig verformte Erythrocyten (siehe unten) und eine schlechte O2-Speicherung.

Man bezeichnet diese Krankheit als Sichelzellanämie.
Sie tritt fast nur bei der schwarz-afrikanischen Bevölkerung auf.

In den USA kann man die Häufigkeit des Auftretens der Abbildung entnehmen.

Bei der schwarzen Bevölkerung tritt sie homozygot 1:400 und heterozygot 1:12 auf. In den Malariagebieten Afrikas findet man sehr häufig die heterozygote Form, da die Sichelform der Erythrozyten den Infektionszyklus des Malaria-Erregers behindert und so dem Merkmalsträger eine Resistenz verliehen wird.

Homozygot ist das Krankheitsbild u.a. von Anämie und Verstopfung der Blutgefäße gekennzeichnet.

Auch bei der Verteilung der Chromosomen bei der Zellteilung können Fehler auftreten, z. B. können die Chromosomen ungleichmäßig auf die neuen Zellen verteilt werden. Eine der neu entstandenen Zellen besitzt nun 1 Chromosom zuviel.

Unten ist ein solcher Fall abgebildet, das Karyogramm eines Menschen mit dem Karyotyp (47, XY, t21). Diese Erbkrankheit hat Folgen für den gesamten Organismus.

Man nennt das Krankheitsbild Down-Syndrom (siehe links).

Die Krankheit tritt bezüglich der lebend geborenen 1:700 auf.

Da bei dieser Krankheit die Anzahl der Chromosomen betroffen ist, bezeichnet man diese Form der Mutationen als Genommutationen.

Als dritten Typ Mutation findet man in vielen Organismen Änderungen der Chromosomenform, z.B. ein verkürztes oder ein ringförmiges Chromosom.

Solche Mutationen nennt man Chromosomenmutationen. Die Abbildung links zeigt eine Verkürzung des Chromosoms (Deletion) und eine Zyklisierung.

Man unterscheidet also 3 Mutationsformen:

  • Genommutation
  • Chromosomenmutation
  • Genmutation

Bei Drosophila ist z.B. die Bar-Mutante, die eine veränderte Augenform besitzt auf eine Deletion der Bar-Gene zurückzuführen. (siehe rechts)

Wir wollen uns nachfolgend nur mit Genmutationen beschäftigen. Die anderen Mutationsformen werden hier besprochen.


Allgemeine Ursachen und Bedeutung der Mutationen

Alle Mutationen bewirken letztlich eine Veränderung, einen Defekt oder das Fehlen von Genen. Dies kann spontan durch

  • Fehler bei der Meiose (Bildung der Gameten) der Eltern oder
  • Fehler bei der DNA-Replikation (1:1000 Basen) oder
  • Faktoren der Umwelt wie elektromagnet. Strahlung (UV, Röntgen), radioaktive Strahlung (a, b,g), Chemikalien oder Temperatur oder
  • Fehler im DNA-Reparaturmechanismus der Zelle

geschehen. Man nennt mutationsauslösende Faktoren Mutagene.

Strahlung

Wir erinnern uns an den Biologiekurs Klasse 11 (Ozon) und 12 (Photosynthese). Von dort wissen wir, daß elektromagnetische Strahlung biologisch um so gefährlicher wird, je kürzer die Wellenlänge unterhalb des sichtbaren Bereichs des Lichts ist.

Bei 260 nm (UV-C-Bereich) liegt weiterhin das Maximum der UV-Absorption der DNA. Normalerweise absorbiert die Atmosphäre schon in 100 Km Höhe den größten Teil der UV-B und C Strahlung. Durch die Ozonlöcher gelangen jedoch mehr dieser Wellenlängen in Bodennähe.

UV-Strahlung bewirkt hauptächlich Thymin-Dimere, was zu einer Strukturänderung der DNA-Helix führt und Replikation und Transkription beeinträchtigt.

Ionisierende Strahlung wie Röntgen- ( 10-12m) und g-Strahlung (10-15m) verursacht

  • Einzelstrangbrüche: wird meist durch die DNA-Ligase repariert
  • Doppelstrangbrüche: sind oft letal, da der Reparaturmechanismus überfordert ist.(siehe unten)
  • oxidative Basenänderungen: sind oft letal, da die Replikation geblockt wird. (siehe unten)

Chemikalien wie HNO2, HNO3, Acrolein (= 2-Propenal entsteht bei Überhitzen von Fett) oder Dioxin wirken durch Interaktion mit der DNA mutagen.

Dioxin lagert sich an Thymin an und verursacht falsch replizierte DNA-Kopien.

 

Viele Pestizide sind mutagen, wie das weltweit verwendete Pestizid Methyl-Bromid (siehe auch Biokurs Klasse 11) wirkt durch Veränderung des Hypoxanthin-Guanin Phosphoribosyl-Transferase Gens (hprt) mutagen.

Wir besitzen Onkogene (Krebsgene), die durch Tumorsuppressorgene unterdrückt werden. Findet in letzteren eine Mutation statt, werden bestimmte Zellen zu Krebszellen.

Krebserregende Stoffe können durch Behinderung der Tumorsuppressorgene oder Aktivierung der Onkogene Krebs auslösen.

Um zu prüfen, ob eine Chemikalie mutagen wirkt führt man den Ames-Test durch. Er beruht auf der Annahme, daß jeder Stoff, der als Mutagen wirkt auch karzinogen ist.

Links ist eine Mutante des Bakteriums Salmonella typhimurium zu sehen, das kein Histidin (His) synthetisieren kann. Der Agar enthält Rattenleber-Enzyme und kein Histidin. Der Papierfilter wurde mit 10µg des Karzinogens 2-Aminofluorin getränkt. Die krebserregende Wirkung sorgte für bei vielen Bakterien für Rückmutationen, denn sie wachsen trotz Histidin-Abwesenheit.

 

Manche Stellen der DNA sind besonders für Mutationen anfällig (siehe unten), man nennt sie Hot Spots.

Die Auswirkungen der Mutagene für den Organismus sind je nach Mutation unterschiedlich.

Komplettes Fehlen von Genen sorgen meist für schwere Störungen des Gesamtstoffwechsels,der Entwicklung und Differenzierung. Defekte Gene sind für viele Erbkrankheiten wie Albinismus, Rotgrün-Blindheit, Bluterkrankheit usw. verantortlich. Leicht veränderte Gene machen sich entweder gar nicht oder durch das Vorhandensein veränderter Proteine (Enzyme) bemerkbar. Dies kann sich positiv auswirken, wie bei den Menschen, die immun gegen das HIV-Virus sind oder negativ auswirken wie bei Sichelzellanämie.

Die Induktion von Mutationen bei Bakterien war in der Forschung von unschätzbarem Wert, um die Wirkung von Genen zu untersuchen. Dazu gehören z. B. die

Resistenzmutation, d.h. ein Bakterium ist resistent gegen ein Antibiotikum oder die

Auxotrophe Mutation, bei der Bakterien, die einen Wuchststoffmangel haben, diesen durch eine Mutation nun selbst herstellen können.

Mutationen sind wichtige Faktoren der Evolution, denn durch sie verändert sich das Genom der Organismen. Vergleichen wir die Aminosäresequenz der b-Kette des Hämoglobins bei verschiedenen Tieren (siehe oben), stellen wir Unterschiede fest, je nach Verwandschaftsgrad. Je näher die Verwandschaft, desto identischer die Sequenz. Bei allen Tieren erfüllt das Molekül seine Funktion. Die Umweltverhältnisse entscheiden, welche der spontanen Mutationen sich positiv oder negativ für den Merkmalsträger auswirkt (=Selektion). (siehe Sichelzellanämie oder HIV-Resistenz)


Beispiele für Genmutationen

Viele Krankheiten bei Mensch, Tier und Pflanze beruhen auf Genmutationen:

Sichelzellanämie, Phenylketonurie, Alkaptonurie, Albinismus, Zellweger Syndrom, Marfan Syndrom usw.

Doch nicht immer wirkt sich eine Genmutation negativ aus.

1. HIV-Resistenz
Ca.1% der Menschen in Europa sind immun gegen eine Infektion des HIV-Virus. Untersuchungen ergaben, daß diese Personen auf Chromosom 3 zwei defekte (mutierte) Gene des T-Zell und Makrophagen-Rezeptors CCR5 (= Chemokiner (C-C) Rezeptor 5) besitzen. Dieser ist als Korezeptor mit dem CD4-Rezeptor für die Injektion der HIV-Nukleinsäure in die Wirtszelle notwendig. Diese Menschen besitzen also eine homozygote Mutation, d.h. auf beiden Chromosomen sitzt das mutierte Gen.

Der CCR5-Rezeptor gehört zu den G-Protein gesteuerten 7-Helix-Transmembran-Rezeptoren, die bei Immunreaktionen für die Signalübertragung mit Chemokinen (z.B. Interleukine) notwendig sind. Die Stimulation über diesen Rezeptor lösen bei Neutrophilen, Basophilen, Eosinophilens, Lymphocyten und Makrophagen eine Wanderung zum Infektionsort aus.

Nachfolgend ist die Situation dargestellt.

Das HIV-Virus benötigt zu seiner Infektion neben dem CD4-Rezeptor u.a. den CCR5 Korezeptor. Normalerweise besitzt der Mensch homozygot 2 Kopien des CCR5-Gens, das für den CCR5-Rezeptor verantwortlich ist. Er ermöglicht mit dem CD4 zusammen die Adsorption und Infektion (a). Nun gibt es einige Individuen, die bezüglich diese Gens einen homozygoten Defekt zeigen, d.h. beide Gene sind defekt und führen zu einem defekten Protein (b), das keine Infektion ermöglicht (c).

Aus der Gendatenbank können wird die Sequenz des CCR5-Gens entnehmen (komplementäre DNA-Sequenz; entspricht der mRNA des Gens mit T statt U)

Nukleotidsequenz des CCR5 Gens:

ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC
CAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTG
TTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGG
CTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTT
CTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATG
TGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATC
CTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG
ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCT
CTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCT
CATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCAT
CTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACT
CTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATC
ATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTC
CAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAG
GTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTC
GGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTC
TGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCC
GATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

schwarz:
Normales Gen ist mit mutiertem Gen identisch

rot:
zum mutierten Gen unterschiedliche Nukleotidsequenzen

(ATG = Startercodon)

 

 
Das mutierte Gen CCR5 Mutant hat folgende Sequenz:

ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC
CAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTG
TTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAG
GCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTT
CTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATG
TGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATC
CTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG
ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCT
CTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCT
CATTTTCCATACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGT
CATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGA 

Der Nukleotidvergleich zeigt, daß ungefähr ab der Mitte des Gens die Sequenz verändert ist und dann ganz fehlt. Man nennt solche Löschungen von Teilen von Genen oder Chromosomen Deletion.

Neben der Deletion gibt es noch andere Genmutationstypen. Wir wollen uns deshalb einmal das menschliche Hämoglobingen genauer betrachten. Hier treten u.a. in der Beta-Kette verschiedene Mutationen auf.

2. Mutationen im Hämoglobin-Gen

Bei der Sichelzellanämie ist in der b-Kette in Position 6 die Base A (GAG = Glutaminsäure) gegen T (GTG = Valin) ausgetauscht. Das Hämoglobin besitzt deshalb eine andere Konformation. Man bezeichnet eine solche Änderung nur einer Base als Punktmutation. Man spricht ebenfalls von einer Fehlsinn-Mutation, da die genetische Information. geändert wurde. Dies liegt auch beim Hb C vor. (siehe oben)

Es gibt jedoch eine Krankheit, bei der noch eine andere Mutation im Gen der b-Kette des Hämoglobins vorliegt, die Thalassämie. Sie kann entweder durch eine Nonsens-Mutation oder eine Rastermutation verursacht werden.

Bei der Nonsens-Mutation entsteht ein Stop-Codon, was zu einem Abbruch der Proteinsynthese und einem unvollständigen und nicht-funktionierenden Hämoglobin führt. Bei der Rastermutation fehlen zwei Basen (AA), was das Triplett-Raster so verschiebt, daß total andere Codogene entstehen und damit falsche Aminosäuren eingebaut werden, was ebenfalls zu einem defekten Hämoglobin führt.

Die Thalassämie kann die a-Kette (a-Thalassämie) oder die b-Kette (b-Thalassämie) des Hämoglobins betreffen.

Das Hämoglobin besitzt bekanntlich 2 a-Ketten und 2 b-Ketten (siehe oben). Das Gen für die b-Kette sitzt auf dem Chromosom 11. Das Chromosom 16 besitzt 2 Gene für die a-Ketten. Thalassämie entsteht, wenn ein Hämoglobingen defekt ist.

Eine leichte Anämie und verkleinerte Erythrozyten treten erst auf, wenn 2 Gene defekt sind. Der Ausfall aller 4 Globin-Gene führt zum embryonalen Tod.

a-Thalassämie tritt vornehmlich in Asien und Afrika auf.

Zusammenfassung der Genmutatationen

Der häufigste Mutationstyp sind Basenpaarungs-Mutationen. Er tritt auf, wenn eine Base ausgetauscht wird, was zu einer falschen Basenpaarung führt, z.B. A wird zu G oder T zu C. Die Folgen sind in der nachfolgenden Tabelle aufgeführt.

Stille Mutationen

 

Meist wird die 3. Base durch eine andere ersetzt, sodaß sich die Basenpaarung zwar ändert, aber wegen des degenerierten Codes bei der Transkription kein anderes Codon entsteht.

 

Fehlsinn-Mutationen

 

Der Basenaustausch führt zu einem anderen Codogen, was letztendlich zu einer anderen Aminosäure führt. (Sichelzellanämie)

 

 Nonsens-Mutationen

 

Durch Basenaustausch entsteht eines der drei Stop-Codone. Dies führt zu einem defekten Protein. (cystische Fibrose)

 

 Raster-Mutationen

 

Durch Einfügen oder Löschen einer Base wird das Triplettraster verändert. Bei der Transkription entsteht so ab der mutierten Stelle eine mRNA mit anderen Codonen, was zu einem nichtfunktionierenden Protein führt. (Huntingtonsche Krankheit)

 

Nukleotidtrimere

 

Nukleotidtrimere sind Abfolgen von 3 Nukleotiden, die sich wiederholen. Mindestens 8 Krankheiten des Nervensystems und der Muskeln beruhen auf dieser Mutationsform.

Mutationsrate

Es ist schwierig, die Mutationsraten genau zu bestimmen, da man nicht weiß, ob es sich bei dem Phänotyp um das Ergebnis einer oder mehrerer Mutationen handelt. Bei der Histidin-Biosynthese ist das Funktionieren von 11 Genen notwendig. Eine His- Mangelmutante kann einen Defekt in einem Gen oder mehrerern Genen besitzen. Ein anderer Grund ist die Tatsache, daß die DNA Bereiche hat, die empfindlicher für Mutationen sind als andere, z.B TT-Regionen. (Hotspots)

Die statistische Wahrscheinlichkeit einer Mutation kann durch:

Pn=mne-m/n!

Pn = Wahrscheinlichkeit, daß n Mutationen in einer Kultur auftreten.

m = ungefähre Anzahl der Mutationen pro Kultur

bestimmt werden.

Bei den meisten Bakteriengenen ist Pn = 10-8. Ansonsten liegt P um 10-10 und 10-12 Mutations pro Basenpaar der DNA pro Generation.

Bei den meisten Eukaryonten-Genen nimmt man einen Wert zwischen 10-5 bis 10-7 an.

Beim Menschen geht man von P =10-4 bis 10-6 aus. Pro Gen ist die Mutationsrate =1 in 100000 Gameten d.h. bei ca. 50000 Genen = 0,5 Mutationen/Gamet.

 


DNA-Reparatur

Die Zellen aller Organismen besitzen normalerweise einen umfangreichen DNA-Reparaturmechanismus. Man könnte also Mutationen auch als Effekt mangelhafter DNA-Reparatur auffassen.

Die Mechanismen der DNA-Reparatur sind inzwischen ganz gut erforscht. Man fand sie u.a. bei Bakterien, Pilzen, Fischen, Amphibien, Säugetieren und dem Menschen.

Sie dienen der Vermeidung des Zelltods, von Mutationen, Replikationsfehlern, dauerhaften DNA-Schäden und Genom-Instabilitäten. Fehler in diesen Prozessen führen zu Krebs und Alterung.

Die Bedeutung der DNA-Reparatur kann man an der Tatsache ablesen, daß die DNA das einzige Molekül ist, das spezifisch repariert wird, alle anderen werden ausgetauscht. Mehr als 100 Gene sind daran beteiligt, sogar bei Organismen mit kleinen Genomen.

Formen der DNA-Beschädigung:

Basenverlust

Die Glykosyl-Bindung am 1´-Ende der Pentose zur Base ist relativ labil. Deshalb verlieren Zellen pro Tag und haploidem Genom mehrere Hundert bis Tausend Basen.

Desaminierung

Die primäre Aminogruppe der Basen ist ebenfalls instabil. Die Base kann leicht in ihre Ketoform überführt werden.

Aus Cytosin enstehen so pro Tag und haploidem Genom ca. 100 Uracile. So wird aus Adenin ----> Hypoxanthin, Guanin ----> Xanthin, und 5-Methyl-Cytosin zu Thymin. Chemikalien wie HNO2 beschleunigen die Desaminierung.

Chemische Modifikation (Oxidation, Alkylierung)

Die Basen der Nukleinsäuren sind gegen eine Reihe von Chemikalien empfindlich. Z. B. Sauerstoff-, Peroxid- und Hydroxil-Radikale oder H2O2, die als normales Nebenprodukt von Oxidationen entstehen, aber auch durch ionisierende Strahlung (Röntgen und g). Dabei werden die Basen oxidiert.
Ein typisches Produkt der Thyminoxidation ist Thyminglykol (siehe rechts).

Viele Umwelt-Chemikalien aber auch zelleigene Stoffe können die DNA alkylieren. Empfindliche Stellen sind die Heteroatome der Basen.

Natürlicherweise entstehen pro Tag und haploidem Genom z.B. mehrere hundert 3-Methyladenin-Nukleotide. Alkylierende Agenzien wie Pestizide und Kampfgase verstärken die Alkylierung, sodaß die natürlichen Reparaturmechanismen überfordert sind.

Thymindimere durch UV

Die häufigsten Photoprodukte durch UV-Licht sind Thymindimere, genauer Pyrimidin-Cyklobutan-Dimere zwischen benachbarten Pyrimidinen. T-T-Dimere werden neben T-C oder C-T-Dimeren am häufigsten gebildet.

Die Abbildung rechts zeigt ein T-T-Dimer. Dabei besteht der Cyklobutanring (blau) in Wirklichkeit aus gleichlangen Bindungen, was das DNA-Molekül an der Stelle verzerrt.

Dimere können auch durch eine einzige kovalente Bindung zwischen dem C-Atom in Position 6 des Pyrimidins und dem C-Atom in Pos. 4 des anderen Pyrimidinrings entstehen.

Replikationsfehler

Bei der Replikation können durch Fehler der DNA-Polymerase Deletionen und eingeschobene Basen entstehen.

Verbindungen zwischen den DNA-Einzelsträngen

Alkylierende Agenzien wie Psoralene, UV-Licht und ionisierende Strahlung können beide Stränge miteinander verbinden.

Verbindungen zwischen den DNA-Einzelsträngen und Proteinen

Alkylierende Agenzien, UV-Licht und ionisierende Strahlung können Einzelstränge mit Proteinen verbinden.

Strangbrüche

Ionisierende Strahlung kann Brüche im Einzelstrang und im gesamten Doppelstrang verursachen.

In Säugetierzellen gibt es folgende Reparaturwege:

  1. Sofortige Reparatur der DNA-Beschädigung
  2. Ausschneiden und Ersetzen der beschädigten Stelle
  3. Toleranz der DNA-Beschädigung, die nicht repariert werden kann und Minimierung der Effekte.

1. Sofortige Reparatur

In den meisten Fällen ist eine sofortige Reparatur aus energetischen Gründen nicht möglich.

In Bakterien, Pilzen, Pflanzen und Tieren jedoch nicht im Menschen wurde ein Reparaturenzym, die Photolyase gefunden, die mit Hilfe des Lichts Dimere beseitigt.

Dagegen besitzen alle Organismen die O6-Methylguanin-DNA Methyltransferase, die direkt die Alkylierung des O6-Methyl-Guanins rückgängig macht, indem sie die Methylgruppe auf ein Cystein in einem Protein überträgt. Auch die DNA-Ligase kann sofort Fehler der Replikation beseitigen.
Daneben gibt es verschiedene Proteine, die z.B. Basenfehlpaarungen nach der Replikation beseitigen.

2. Ausschneiden (Exzision) und Ersetzen defekter oder modifizierter Basen

Dies ist der allgemeine Weg um mit Hilfe der DNA- N-Glycosylase die defekten oder alkylierten Basen zu ersetzen. Man fand in allen Organismen eine große Anzahl verschiedener Enzyme.

3. Ausschneiden und Ersetzen ganzer Nukleotide (NER)

In allen Organismen geschieht dies wie folgt:

  • Erkennung der beschädigten Stelle
  • Bindung eines Multiproteinkomplexes an die beschädigte Stelle
  • Ausschneiden der beschädigten Stelle( mehrere Nukleotide) an beiden DNA-Strängen
  • Auffüllen der fehlenden Nukleotidsequenz durch DNA Polymerase und Ligase.

Eukaryonten enthalten verschiedene Proteine zur Reparatur, je nach Lage der Beschädigung.
Links ist das XPC-XPA-System für allgemeine Schäden von Genen am nicht-transkribierten Strang abgebildet.

Liegt der Schaden in einem transkribierten Gen, wird die "Transkriptions-gekoppelte Reparatur" (TCR)

durch die RNA Polymerase II stimuliert (siehe links). Hierzu gehören mehr als 10 Proteine und Enzyme.

Links das TCR-Reparatur-System.

Es gibt Krankheiten, bei denen die Gene dieser Reparaturproteine defekt sind:

Xeroderma Pigmentosum (XP), Cockayne's Syndrom (CS) und Trichothiodystrophy (TTD) oder Ataxia-telangiectasia (1:40,000 Geburten -1:100,000).

Reparatur von Doppelstrangbrüchen

Man kennt 2 Systeme zur Reparatur von Doppelstrangbrüchen. Das eine erhält die Information vom Schwesterchromosom, das andere verbindet die Enden einfach (NHEJ= non-homologous end joining).

Weiterführende Quellen:

Realisierung der genet. Information

http://gened.emc.maricopa.edu/bio/bio181/BIOBK/BioBookPROTSYn.html

Gene und Krankheiten

http://www.ncbi.nlm.nih.gov/disease/

Gendatenbank (Mensch)

http://www.ncbi.nlm.nih.gov/Schuler/UniGene/

Krankheiten aufgund von Mutationen im DNA-Reparatursystem

http://www.biols.susx.ac.uk/biols/MRC/alan/alan.htm
http://www.neuro.wustl.edu/neuromuscular/ataxia/dnarep.html

Genmutationen

http://fp.bio.utk.edu/microbio411/index.htm

Dioxin

http://www.enviroweb.org/enviroissues/dioxin/

Kanzerogene Pestizide

http://www.neuro.wustl.edu/neuromuscular/ataxia/dnarep.html
http://www.newsrx.com/
http://ace.ace.orst.edu/info/extoxnet/pips/methylbr.htm
http://website.lineone.net/~mwarhurst/

Chemische Kampfstoffe

http://www.mitretek.org/mission/envene/chemical/chem_back.html

Acrolein

http://www.hhmi.org/science/labsafe/lcss/header3.html

DNA-Reparatur

http://mcbio.med.buffalo.edu/RPN530/DNA_Repair.html

Onkogene

http://www.ultranet.com/~jkimball/BiologyPages/O/Oncogenes.html